Recent Updates: Running 'Cause I Can't Fly

Visit http://coyoteprime-runningcauseicantfly.blogspot.com For Recent Updates.

This Blog Posts All Posts Directory Listings Articles

Musical Interlude: Liquid Mind, “Night Light”

06/29/2016 22:26:35 PM

Liquid Mind, “Night Light” > read more

"A Look to the Heavens"

06/29/2016 22:24:14 PM

“This beautiful telephoto composition spans light-years in a natural night skyscape from the island of Crete. Looking south, exposures both track the stars and record a fixed foreground in three merged panels that cover a 10x12 degree wide field of > read more

Chet Raymo, "The Avid Pursuer"

06/29/2016 22:20:54 PM

"The Avid Pursuer"by Chet Raymo"In his autobiography, "Speak Memory," the novelist and lepidopterist Vladimir Nabokov writes of the joys of butterfly collecting: "The highest enjoyment of timelessness...is when I stand among rare butterflies and thei > read more

"Believe in Yourself!"

06/29/2016 22:10:55 PM

"Believe in Yourself!"by Jill Badonsky“What you are is a question only you can answer.”— Lois McMaster Bujold"We tend to be attracted to confident, bold, defiant people in the world. Many times audacity can go further than even talent. The tale > read more

The Poet: Mary Oliver, "The Summer Day"

06/29/2016 21:33:12 PM

"The Summer Day""Who made the world?Who made the swan, and the black bear?Who made the grasshopper?This grasshopper, I mean–the one who has flung herself out of the grass,the one who is eating sugar out of my hand,who is moving her jaws back and fo > read more

The Daily "Near You?"

06/29/2016 19:15:59 PM

Tewkesbury, Gloucestershire, United Kingdom.Thanks for stopping by! > read more

“Ignorance Is Bliss”

06/29/2016 19:09:23 PM

“Ignorance Is Bliss”by Michael Brenner > read more

"The Idiot Culture..."

06/29/2016 19:08:56 PM

"We are in the process of creating what deserves to be called the idiot culture. Not an idiot sub-culture, which every society has bubbling beneath the surface and which can provide harmless fun; but the culture itself. For the first time, the weird > read more

"To Others And To Ourselves: Obligations"

06/29/2016 19:02:43 PM

"To Others And To Ourselves: Obligations"by Madisyn Taylor, The DailyOM"When we schedule too much in our lives trying to meet our obligations, we only end up draining our energy. We all encounter obligations in life, from spending time with family an > read more

Paul Craig Roberts, “The Collapse of Western Democracy”

06/29/2016 18:12:29 PM

“The Collapse of Western Democracy”by Paul Craig Roberts"A nation of sheep will beget a government of wolves."- Edward R. Murrow"Then you will see the rise of the men of the double standard- the men who live by force, yet count on those who live > read more

Musical Interlude: Yanni, “For All Seasons”

06/28/2016 22:26:14 PM

Yanni, “For All Seasons” (HD)- https://www.youtube.com/watch?list=RDLKA-3Qh6iFw&v=SF06466MdIc > read more

"A Look to the Heavens"

06/28/2016 22:12:33 PM

“It's the bubble versus the cloud. NGC 7635, the Bubble Nebula, is being pushed out by the stellar wind of massive central star BD+602522. Next door, though, lives a giant molecular cloud, visible to the right. At this place in space, an irresistib > read more

“The Dream of a Ridiculous Man”

06/28/2016 22:11:01 PM

“The Dream of a Ridiculous Man”"For I have seen the truth; I have seen and I know that people can be beautiful and happy without losing the power of living on earth. I will not and cannot believe that evil is the normal condition of mankind. And > read more

Chet Raymo, "How Things Are"

06/28/2016 22:04:34 PM

"How Things Are"by Chet Raymo"Any global tradition needs to begin with a shared worldview - a culture-independent, globally accepted consensus as to how things are. From my perspective, this part is easy. How things are is, well, how things are: our > read more

The Poet: David Wagoner, “Old Man, Old Man”

06/28/2016 21:52:34 PM

“Old Man, Old Man”"Young men, not knowing what to remember,Come to this hiding place of the moons and years,To this Old Man. Old Man, they say, where should we go?Where did you find what you remember? Was it perched in a tree?Did it hover deep in > read more

The Daily "Near You?"

06/28/2016 21:47:04 PM

Barre, Vermont, USA. Thanks for stopping by! > read more

“America’s One-Party Government”

06/28/2016 18:15:31 PM

“America’s One-Party Government”by Eric Zuesse"Introduction: > read more

"How It Really Is"

06/28/2016 17:48:10 PM

> read more

"Total Contempt..."

06/28/2016 17:40:17 PM

“You know, I've been around the ruling class all my life, and I've been > read more

Gregory Mannarino, “The Stock Market Is Going To Face A ‘Shock And Awe’ Moment”

06/28/2016 17:33:46 PM

Gregory Mannarino, “The Stock Market Is Going To Face A ‘Shock And Awe’ Moment”- > read more

Chet Raymo, "As Time Goes By"

06/27/2016 22:12:07 PM

> read more

The Daily "Near You?"

06/27/2016 21:25:07 PM

Odessa, Texas, USA. Thanks for stopping by! > read more

"It Becomes Sad..."

06/27/2016 20:41:20 PM

"Why does truth carry such a dreadful face? Why does subjugation carry > read more

Gregory Mannarino, “MELTDOWN: Global Stock Markets Continue To Plunge”

06/27/2016 20:06:28 PM

Gregory Mannarino, “MELTDOWN: Global Stock Markets Continue To Plunge”- > read more

"It's A Mess, Ain't it?"

06/27/2016 17:53:33 PM

Deputy Wendell: > read more

Musical Interlude: Kevin Kern, “Another Realm”

06/27/2016 17:34:33 PM

Kevin Kern, “Another Realm”- > read more

"Martial Law by Executive Order"

06/27/2016 17:17:34 PM

Benito Mussolini defined Fascism as the "merger of government and corporatism." We've witnessed the financial rape of this country by the banksters and their co-conspirators in the government, who have failed to prosecute a single case against any of > read more

"How It Really Is"

06/27/2016 17:14:22 PM

Hilly, you narcissistic, psychopathic, compulsively lying swine, > read more

Stock Market Updates: "Dow Drops 300 Points As Stocks Extend Losses; Materials Off 3%"

06/27/2016 15:14:41 PM

"Dow Drops 300 Points As Stocks Extend Losses; Materials Off 3%"by Evelyn Cheng10:57 AM EST > read more

The Economy: Jim Kunstler, "Death to All Zombies!"

06/27/2016 11:05:03 AM

"Death to All Zombies!" > read more

“Fears After "BREXIT" - Dumping of Euro/Eurobonds, Runs on Banks, Riots and Martial Law”

06/27/2016 00:30:25 AM

A Comment: This post is not intended in any way to frighten you. Do not panic and allow fear to control you! Some of you will instantly dismiss it as sensationalistic nonsense. That's fine too, believe what you need to. The fact of the matter is that > read more

“We Just Witnessed The Greatest One Day Global Stock Market Loss In World History”

06/26/2016 23:01:16 PM

“We Just Witnessed The Greatest One Day > read more

Post # 35,000: Psychology: “Thoughts That Win”; "Afformations: Change Your Life!"

06/26/2016 21:24:26 PM

“Thoughts That Win”by > read more

Musical Interlude: Deuter, “Waves of Light”

06/26/2016 21:23:51 PM

Deuter, “Waves of Light”- > read more

"A Look to the Heavens

06/26/2016 21:20:58 PM

“This dance is to the death. Along the way, as these two large galaxies duel, a cosmic bridge of stars, gas, and dust currently stretches over 75,000 light-years and joins them. The bridge itself is strong evidence that these two immense star syste > read more

The Daily "Near You?"

06/26/2016 20:25:33 PM

Colorado Springs, Colorado, USA. Thanks for stopping by! > read more

"The 12 Rules of Survival"

06/26/2016 16:25:20 PM

> read more

"Just Remember..."

06/26/2016 16:22:41 PM

"I know the world seems terrifying right now and the future seems bleak. Just remember human beings have always managed to find the greatest strength within themselves during the darkest hours. When faced with the worst horrors the world has to offer > read more

Midday Musical Interlude: Leonard Cohen, “Hallelujah”

06/26/2016 14:38:42 PM

Leonard Cohen, “Hallelujah”- > read more

The Economy: Gregory Mannarino, "Post Brexit: The New Agenda Of Fear”

06/26/2016 10:10:57 AM

Gregory Mannarino, "Post Brexit: The New Agenda Of Fear”- > read more

“Oreo Rolling Its Cookie Factory to Mexico”

06/25/2016 22:58:58 PM

“Oreo Rolling Its Cookie Factory to Mexico”By Jim Hightower > read more

Musical Interlude: Josh Groban, “Remember When It Rained”

06/25/2016 21:45:44 PM

Josh Groban, “Remember When It Rained”- > read more

Musical Interlude: Vangelis, “Cosmos, A Tour of the Universe”

06/25/2016 21:36:26 PM

Vangelis, “Cosmos, A Tour of the Universe”- > read more

"A Look to the Heavens"

06/25/2016 21:25:20 PM

"This wide, sharp telescopic view reveals galaxies scattered beyond the stars and faint dust nebulae of the Milky Way at the northern boundary of the high-flying constellation Pegasus. Prominent at the upper right is NGC 7331. A mere 50 million light > read more

Chet Raymo, “The Burden Of Thinking”

06/25/2016 21:18:05 PM

“The Burden Of Thinking”by Chet Raymo“Let me speak for gray. Not black or white. Good or evil. Truth or falsity. Yes or no. Let me speak for maybe. Sort of. More or less. I think so. > read more

"Is Life Embedded in the Cosmos?"

06/25/2016 20:28:12 PM

"Is Life Embedded in the Cosmos?"by Luke McKinney."A recent mathematical analysis* > read more

Rainer Maria Rilke, "And Yet"

06/25/2016 20:16:47 PM

"And Yet""And yet, though we strainagainst the deadening gripof daily necessity,I sense there is this mystery:All life is being lived.Who is living it then?Is it the things themselves,or something waiting inside them,like an unplayed melody in a flut > read more

The Daily "Near You?"

06/25/2016 19:58:00 PM

Vila Velha, Espirito Santo, Brazil. Thanks for stopping by! > read more

"Big Brother’s Virtual Reality”

06/25/2016 19:47:06 PM

"Big Brother’s Virtual Reality”by Linh Dinh"A billboard for Comcast pitches a lineup of “reality” shows, with this caption, “Recommended for you. Because real reality is boring.” In contemporary America, real reality is also less real tha > read more

“Do Americans Live In A False Reality Created By Orchestrated Events?”

06/25/2016 19:04:50 PM

“Do Americans Live In A False Reality Created By Orchestrated Events?”by Paul Craig Roberts"Most people who are aware and capable of thought have given up on what is called the “mainstream media.” The presstitutes have destroyed their credibi > read more

Yanni, “Live at the Acropolis: Until The Last Moment”

06/24/2016 21:52:28 PM

Yanni, “Live at the Acropolis: Until The Last Moment”- > read more

"Reports Coming-in: Credit/Debit Cards and ATM's "Down"- Banking Crisis?" Updates As Available

06/24/2016 21:41:52 PM

"Reports Coming-in: > read more

"A Look to the Heavens"

06/24/2016 21:41:41 PM

“These three bright nebulae are often featured in telescopic tours of the constellation Sagittarius and the crowded starfields of the central Milky Way. In fact, 18th century cosmic tourist Charles Messier cataloged two of them; M8, the large nebul > read more

Chet Raymo, "Life"

06/24/2016 21:33:37 PM

"Life"by Chet Raymo"ACCTCCTCTAATGTCAACCTCCCCTAATGTCA""The first string of letters above represents an actual sequence of amino acids on human chromosome 10. The second string is the corresponding sequence for an elephant. I copy the strings from a "N > read more

The Poet: Fernando Pessoa, “Tobacco Kiosk”

06/24/2016 20:45:40 PM

“Tobacco Kiosk”"I am nothingI shall always be nothingI cannot wish to be anything.Aside from that, I have within me all the dreams of the world.Windows of my room,The room of one of the world's millions nobody knows about(And if they knew about m > read more

"You Cannot Kill Me Here..."

06/24/2016 20:35:34 PM

"You cannot kill me here. Bring your soldiers, your death, your disease, your collapsed economy because it doesn't matter, I have nothing left to lose and you cannot kill me here. Bring the tears of orphans and the wails of a mother's loss, bring you > read more

A Much Needed Musical Interlude: Deuter, “Black Velvet Flirt”

06/24/2016 17:44:06 PM

Deuter, “Black Velvet Flirt”- > read more

The Daily "Near You?"

06/24/2016 17:41:04 PM

Cambridge, Cambridgeshire, United Kingdom. Thanks for stopping by! > read more

"A Message From The Hopi Elders"

06/24/2016 17:38:15 PM

"A Message From The Hopi Elders""You have been telling the people that this is the Eleventh Hour.Now you must go back and tell the people that this is The Hour.Here are the things that must be considered:Where are you living?What are you doing?What a > read more

"You Are The One You Are Waiting For: Turn To Yourself"

06/24/2016 17:34:44 PM

"You Are The One You Are Waiting For: Turn To Yourself"by Madisyn Taylor, The DailyOM"Ultimately, you are the one. We spend a lot of our lives looking for role models, mentors, teachers, and gurus to guide us on our path. There is nothing wrong with > read more

The Economy: "CRITICAL ALERT! Brexit Causes World Stock Markets To FREEFALL"

06/24/2016 00:48:33 AM

Gregory Mannarino, "CRITICAL ALERT! Brexit Causes World Stock Markets To FREEFALL"- > read more

Musical Interlude: Loreena McKennitt, “Caravanserai”

06/23/2016 21:36:53 PM

Loreena McKennitt, “Caravanserai”- > read more

"A Look to the Heavens"

06/23/2016 21:27:18 PM

“A Full Moon sets as the Solstice Sun rises in this June 20 dawn skyscape. Captured from a nearby peak in central California, planet Earth, the scene looks across the summit of Mount Hamilton and Lick Observatory domes on a calendar date that marks > read more

Chet Raymo, "Free As A Bird"

06/23/2016 21:10:58 PM

"Free As A Bird"by Chet Raymo"All afternoon I have been watching a pair of hummingbirds play about our porch. They live somewhere nearby, though I haven't found their nest. They are attracted to our hummingbird feeder, which we keep full of sugar wat > read more

"America– the Most Frightened Nation on Earth"

06/23/2016 18:56:18 PM

"America– the Most Frightened Nation on Earth"by Finian Cunningham"What happens to people living in a society where everyone in power is lying, stealing, cheating and killing, and in our hearts we all know this, but the consequences of facing all t > read more

Free Download: Viktor Frankl, "Man's Search For Meaning"

06/23/2016 18:08:27 PM

"Man's Search For Meaning" > read more

The Daily "Near You?"

06/23/2016 17:18:15 PM

Darmstadt, Hessen, Germany. Thanks for stopping by! > read more

"Southern California Time Bomb: The Ground Surrounding The San Andreas Fault Is ‘Rising And Sinking’"

06/23/2016 16:42:33 PM

"Southern California Time Bomb: > read more

"Words Are Energy: The Music Of Language"

06/23/2016 16:28:59 PM

"Words Are Energy: The Music Of Language"by Madisyn Taylor, The DailyOM"Each word we speak has a life of its own, a vibratory signature that creates waves into the expanse of the universe. When we speak or write, we use the vehicles of words to carry > read more

"The Most Damned Of All..."

06/23/2016 16:25:40 PM

“Damned is the soul that dies while the evil it committed lives on. And the most damned of all are those who see the evil coming for others and refuse to confront it. For it is not out of fear that heroes are born, but rather out of their selfless > read more

"The Best Method..."

06/22/2016 19:29:30 PM

> read more

Musical Interlude: Adiemus, “In Caelum Fero”

06/22/2016 19:24:53 PM

Adiemus, “In Caelum Fero”- > read more

"Hillary Clinton's IT Aide Pleads The Fifth Over 125 Times"

06/22/2016 19:19:27 PM

"Hillary Clinton's IT Aide Pleads The Fifth Over 125 Times"by Tyler Durden"If the Obama administration defines itself as the "most transparent ever", one wonder what will be the term describing Hillary Clinton's potential presidency. We ask, because > read more

Paulo Coelho, “The Mechanism of Terror”

06/22/2016 19:10:33 PM

“The Mechanism of Terror”by Paulo Coelho“An old legend tells of how a certain city in the Pyrenees mountains used to be a stronghold for drug-traffickers, smugglers and exiles. The worst of them all, called Ahab, was converted by a local monk, > read more

"A Look to the Heavens"

06/22/2016 19:08:37 PM

"Hot blue stars shine brightly in this beautiful, recently formed galactic or "open" star cluster. Open cluster NGC 3293 is located in the constellation Carina, lies at a distance of about 8000 light years, and has a particularly high abundance of th > read more

The Economy: Gregory Mannarino, "100% Absolute Proof That The Federal Reserve Is Lying"

06/22/2016 16:44:23 PM

Gregory Mannarino, "100% Absolute Proof That The Federal Reserve Is Lying"- > read more

"The Darkest Hours..."

06/22/2016 16:34:48 PM

“Sometimes we love with nothing more than hope. Sometimes we cry with everything > read more

The Daily "Near You?"

06/22/2016 16:25:13 PM

Lexington, Kentucky, USA. Thanks for stopping by! > read more

Free Download: Edward Bernays, "Propaganda"

06/22/2016 16:17:47 PM

"The conscious and intelligent manipulation of the organized habits and opinions of the masses is an important element in democratic society. Those who manipulate this unseen mechanism of society constitute an invisible government which is the true r > read more

“When All They Have is Fear”

06/22/2016 15:58:48 PM

“When All They Have is Fear”Be afraid, very afraid…but make sure you’re afraid of the right things.by Robert Gore"An institution that claims the right to initiate force and has the means to do so is an institution to be feared. History confir > read more

"Why Else?"

06/22/2016 00:22:15 AM

"We Americans are not usually thought to be a submissive people, but of course we are. Why else would we allow our country to be destroyed? Why else would we be rewarding its destroyers? Why else would we all- by proxies we have given to greedy corpo > read more

Geopolitics: “Jordan Declares Border with Syria "Military Operations Zone", Troops Massing”

06/22/2016 00:00:53 AM

“Jordan Declares Border with Syria "Military Operations Zone", Troops Massing”by Newroom“In a very serious development, the government of Jordan has declared its entire border with Syria to be a "military operations zone" and large numbers of J > read more

Musical Interlude: 2002, “Believe”

06/21/2016 21:39:07 PM

2002, “Believe”- > read more

Free Download: "The Power of Now, A Guide to Spiritual Enlightenment"

06/21/2016 21:34:53 PM

"The Power of Now, A Guide to Spiritual Enlightenment" > read more

Musical Interlude: Peter Kater, “Heaven's Window”

06/21/2016 20:19:27 PM

Peter Kater, “Heaven's Window”- > read more

"A Look to the Heavens"

06/21/2016 20:09:52 PM

“In the center of this serene stellar swirl is likely a harrowing black-hole beast. The surrounding swirl sweeps around billions of stars which are highlighted by the brightest and bluest. The breadth and beauty of the display give the swirl the de > read more

Chet Raymo, “The Wild Silence And The Wild Dark”

06/21/2016 20:05:36 PM

“The Wild Silence And The Wild Dark”by Chet Raymo"It is probably obvious by now that I have been reading Yeats. So let me share one more poem, "He Wishes for the Cloths of Heaven":“Had I the heavens' embroidered cloths,Enwrought with golden and > read more

"Taking A Break From What You Are Doing: A New Approach"

06/21/2016 19:25:50 PM

"Taking A Break From What You Are Doing: A New Approach"by Madisyn Taylor, The DailyOM"Sometimes finding the answer is as easy as taking a break and stepping back from the situation. Sometimes we can get so wrapped up in our thoughts that we wind up > read more

"U.S. Supreme Court Guts Fourth Amendment and Sanctions Police Fishing Expeditions, Giving Police More Leeway to Stop, Arrest and Search Citizens"

06/21/2016 16:13:54 PM

"U.S. Supreme Court Guts Fourth Amendment and Sanctions Police Fishing Expeditions, > read more

The Daily "Near You?"

06/21/2016 15:53:12 PM

Lugansk, Zaporiz'ka Oblast', Ukraine. Thanks for stopping by! > read more

Musical Interlude: Ludovico Einaudi, "Elegy for the Arctic"

06/21/2016 00:22:53 AM

Ludovico Einaudi, "Elegy for the Arctic"- > read more

"A Look to the Heavens"

06/20/2016 18:57:24 PM

“Today the Sun reaches its northernmost point in planet Earth's sky. Called a solstice, the date traditionally marks a change of seasons- from spring to summer in Earth's Northern Hemisphere and from fall to winter in Earth's Southern Hemisphere. > read more

Chet Raymo, “The Radiance Of What Is”

06/20/2016 18:53:31 PM

“The Radiance Of What Is”by Chet Raymo“In the summer of 1936, as I nestled snug in my mother's womb, Fortune magazine sent the young writer James Agee and the photographer Walker Evans to rural Alabama to report on how the Great Depression was > read more

The Poet: Samuel Taylor Coleridge, “What If?”

06/20/2016 18:52:11 PM

“What If?”“What if you slept?And what if,In your sleepYou dreamed?And what if,In your dream,You went to heavenAnd there pluckedA strange andBeautiful flower?And what if,When you awoke,You had the flowerIn your hand?… Ah, what then?” > read more

"The Otters Of The Universe..."

06/20/2016 18:48:48 PM

“We are game-playing, fun-having creatures, we are the otters of the universe. We cannot die, we cannot hurt ourselves any more than illusions on the screen can be hurt. But we can believe we’re hurt, in whatever agonizing detail we want. We can > read more

“Defense Mechanisms: Beyond Behavior”

06/20/2016 18:37:55 PM

“Defense Mechanisms: Beyond Behavior”by Madisyn Taylor, The DailyOM“We can let go of our defense mechanisms when we are ready to be truly honest with ourselves. We all have defense mechanisms that we’ve developed over time, often without bein > read more

The Daily "Near You?"

06/20/2016 18:34:12 PM

Reading, United Kingdom. Thanks for stopping by! > read more

"All Is Not Lost..."

06/20/2016 18:33:08 PM

"If you can't answer a man's arguments, all is not lost;you can still call him vile names."- Elbert Hubbard > read more

Dmitry Orlov, "The 5 Stages of Economic Collapse"

06/20/2016 18:29:13 PM

> read more

"The Rule..."

06/20/2016 18:18:52 PM

“Insanity in individuals is something rare,but in groups, parties, nations and epochs it is the rule.” > read more



© 2006-2016 OnToplist.com, All Rights Reserved